rs2073489 chr1:226875970 T>C
- Sequence
aggctttccagaacgtagtctatg[T/C]tggacacttccttctgcctctctg
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- RING2_HUMAN EMSY_HUMAN KDM1A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RING2_HUMAN | n/a | 2.76 | 2.50 | n/a | n/a | |||
| EMSY_HUMAN | -3.98 | 2.22 | 2.50 | n/a | n/a | |||
| KDM1A_HUMAN | -2.38 | 1.83 | 2.50 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, height, hypertension (early onset hypertension), ldl cholesterol, total cholesterol, waist hip ratio
GTEx eQTL Adrenal_Gland, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Frontal_Cortex_BA9, Brain_Hippocampus, Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Lung, Muscle_Skeletal, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid, Whole_Blood