rs2074451 chr19:1107036 T>G
- Sequence
gtgcacaggcagggcctggtgtag[T/G]gccgagtcttggaggagataattc
- ASB in cell types
- HEK293 (embryonic kidney) K562 (myelogenous leukemia) RWPE1 (prostate epithelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.11 | 0.90 | 1.98 | |||
| K562 (myelogenous leukemia) | -0.41 | 0.82 | 2.00 | |||
| RWPE1 (prostate epithelial cells) | 1.66 | -1.72 | 1.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP hdl cholesterol, irritible bowel syndrome, n-acetyl-p-benzoquinonimine (napqi) ic50 values, parkinsons disease, stabilized warfarin dose
GTEx eQTL Adrenal_Gland, Brain_Cerebellum, Brain_Cortex, Brain_Hippocampus, Colon_Transverse, Esophagus_Mucosa, Muscle_Skeletal, Pancreas, Thyroid, Whole_Blood