rs2075477 chr14:21749072 G>A
- Sequence
ttgacttctgtgagtaggctgacg[G/A]cagaagcagatgcctctgtggaca
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) A549 (lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 0.63 | 0.19 | 1.51 | |||
| A549 (lung carcinoma) | 0.68 | -0.25 | 2.00 |
Items per page:
1 – 2 of 2