rs2076706 chr22:25778201 G>T
- Sequence
gaagagtgaagcttcaagggcaga[G/T]tctacactcatgagaagctaatag
- ASB in cell types
- foreskin keratinocyte GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | -2.99 | 2.16 | 2.50 | |||
| GM12878 (female B-cells) | 0.20 | 1.40 | 1.33 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP bipolar disorder, fasting blood glucose, hdl cholesterol change with statins, refractive error, schizophrenia, urinary albumin-to-creatinine ratio