rs208296 chr12:121163150 G>A
- Sequence
agaaagacctggattcaattccta[G/A]ctctaacaccattttgctgtgtgt
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.32 | 0.93 | 2.01 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP hdl cholesterol, neuroticism, refractive error, rheumatoid arthritis, combined control dataset, total cholesterol, triglycerides change with statins, waist hip ratio
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Nerve_Tibial, Thyroid, Whole_Blood