rs208717 chr6:148566506 C>A
- Sequence
gcaccacccatgcaaatacacaag[C/A]atttcctctttgactgactcactt
- ASB in cell types
- periferal blood macrophages GM12878 (female B-cells)
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 2.47 | -0.46 | 2.25 | -3.20 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP ldl cholesterol change with statins, maternal transmission distortion, parkinsons disease, total cholesterol change with statins