rs2093216 chr14:39204239 C>T
- Sequence
agtctgagctcagacatgcctagc[C/T]ctgcccccacctgatgggccttcc
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) HepG2 (hepatoblastoma)
- ASB for transcription factors
- RFX1_HUMAN ZFX_HUMAN ELF1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RFX1_HUMAN | 2.33 | -0.42 | 1.50 | n/a | No Hit | |||
| ZFX_HUMAN | 1.46 | -0.26 | 1.70 | n/a | No Hit | |||
| ELF1_HUMAN | 1.88 | -1.81 | 1.50 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Lung, Nerve_Tibial, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid