rs209485 chr6:53309650 T>C
- Sequence
cagaataaagcaaaagggatggta[T/C]gtcgcttctgggattaggtgataa
- ASB in cell types
- ICN12 (primary pre-B acute lymphomablastic leukemia) GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| ICN12 (primary pre-B acute lymphomablastic leukemia) | -0.60 | 1.21 | 1.50 | |||
| GM12878 (female B-cells) | -1.30 | 1.48 | 1.33 |
Items per page:
1 – 2 of 2