rs209524 chr6:53348428 G>C
- Sequence
ctctcccgccgcgcgctccggccc[G/C]cagggcgggaggacccaggcggac
- ASB in cell types
- HepG2 (hepatoblastoma) thymus-derived CD34- cells
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | -0.16 | 0.81 | 2.00 | |||
| thymus-derived CD34- cells | -1.66 | 1.99 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Brain_Caudate_basal_ganglia, Brain_Putamen_basal_ganglia, Thyroid, Whole_Blood