rs2096064 chr9:122499189 G>A
- Sequence
cctgcgggtcccttgatggcaggc[G/A]taagaaccaatgccaatggagaat
- ASB in cell types
- KMS-11
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| KMS-11 | -2.31 | 1.88 | 1.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP ldl cholesterol, stabilized warfarin dose, total cholesterol, urinary albumin-to-creatinine ratio