rs209958 chr20:54100633 T>G
- Sequence
catgattgaattacctcccaccag[T/G]ttcttcccaccacatgtgggaatt
- ASB in cell types
- GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | n/a | 1.14 | 1.44 |
Items per page:
1 – 1 of 1