rs210796 chr6:135189970 A>T
- Sequence
ttcctatttgaggaagcaggtaaa[A/T]tgggcaaacaggaagtagaggact
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.55 | -0.25 | 1.90 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, ldl cholesterol change with statins, mean corpuscular hemoglobin concentration (mchc), mean corpuscular volume (mcv), red blood cell count (rbc)
GTEx eQTL Adipose_Subcutaneous, Esophagus_Mucosa, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Whole_Blood