rs210920 chr6:11710321 G>A
- Sequence
tttatgcctctgtaatctacaacc[G/A]gatgcgctcttacacccaagcctt
- ASB in cell types
- GM12878 (female B-cells) Th1-cells
- ASB for transcription factors
- TBX21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TBX21_HUMAN | 1.48 | -1.31 | 1.33 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP college completion, hdl cholesterol, plasma brain natriuretic peptide (bnp), prop taste detection threshold, rheumatoid arthritis, transmission distortion, years of education