rs211389 chr10:32005083 T>G
- Sequence
cgttgtacctagaaacctaaagca[T/G]catcataggggccgcagatggagg
- ASB in cell types
- transverse colon
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.76 | 0.46 | 1.40 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP biploar disorder (bipolar schizoaffective disorder), height, height in type 2 diabetes cases, ldl cholesterol change with statins, microalbuminuria, neuroticism, simpson-angus scale, systolic blood pressure (sbp), triglycerides, urinary albumin-to-creatinine ratio, years of education