rs211391 chr10:32005173 G>A
- Sequence
agcacatgctctgtggatccctct[G/A]ctggtcatttccgtgtctctgatg
- ASB in cell types
- foreskin keratinocyte RH4 (alveolar rhabdomyosarcoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 0.44 | n/a | 2.50 | |||
| RH4 (alveolar rhabdomyosarcoma) | 2.01 | -2.63 | 1.50 |
Items per page:
1 – 2 of 2