rs2117545 chr3:191291372 G>C
- Sequence
tttgagtactataagaaactatta[G/C]ctacttgaaagtcacaaagattta
- ASB in cell types
- GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | 0.26 | 0.58 | 1.30 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, ldl cholesterol change with statins, neuroticism, refractive error, total cholesterol, total cholesterol change with statins
GTEx eQTL Artery_Aorta, Artery_Tibial, Brain_Amygdala, Cells_Cultured_fibroblasts, Nerve_Tibial, Thyroid