rs2121132 chr5:54732833 C>A
- Sequence
aatgtttttgtctactgattctac[C/A]agttgtggcatttctgggtgtgtt
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.26 | 0.65 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP ldl cholesterol, lp-pla2 activity, neuroticism, type 1 diabetes, rheumatoid arthritis, combined case analysis, gender differentiated