rs212175 chr16:72493348 C>T
- Sequence
cacacacatacacacacacacaca[C/T]cctatggctagaaaaatatgaatt
- ASB in cell types
- LNCaP (prostate carcinoma)
- ASB for transcription factors
- ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | 1.21 | -0.31 | 1.43 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP height, hypertension (early onset hypertension), irritible bowel syndrome, parkinsons disease (pd), sporadic creutzfeldt-jakob disease