rs2134271 chr1:244757518 A>G
- Sequence
agccctcaatggctaggataagtg[A/G]tatgctccagtctctgctttgttc
- ASB in cell types
- LNCaP (prostate carcinoma)
- ASB for transcription factors
- FOXA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXA1_HUMAN | 0.05 | 1.75 | 1.62 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, hdl cholesterol, hdl cholesterol change with statins, hip bone mineral density (bmd), neuroblastoma (brain cancer), obesity with early age of onset (age >2), primary rhegmatogenous retinal detachment, triglycerides