rs2136420 chr11:119729606 G>A
- Sequence
cggctagcagcgtgggagctggca[G/A]ggcttctgcaagccctctgctccc
- ASB in cell types
- neutrophils MM1.S (plasma cell myeloma) GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neutrophils | 1.92 | 0.05 | 1.67 | |||
| MM1.S (plasma cell myeloma) | -0.49 | 0.92 | 1.21 | |||
| GM12878 (female B-cells) | 0.31 | 0.57 | 1.28 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Brain_Amygdala, Brain_Anterior_cingulate_cortex_BA24, Brain_Caudate_basal_ganglia, Brain_Cortex, Brain_Hippocampus, Brain_Putamen_basal_ganglia, Brain_Spinal_cord_cervical_c-1, Cells_Cultured_fibroblasts, Heart_Atrial_Appendage, Pancreas