rs213764 chr1:41117397 A>G
- Sequence
agggctccttggtctagcggtaac[A/G]ccagcgtctgggaagacgcccgtt
- ASB in cell types
- bipolar neuron GM23338 epithelial cell of prostate
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| bipolar neuron | 2.66 | -3.32 | 1.33 | |||
| GM23338 | 2.17 | -2.21 | 1.33 | |||
| epithelial cell of prostate | 1.80 | n/a | 1.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Brain_Anterior_cingulate_cortex_BA24, Brain_Cerebellar_Hemisphere, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Atrial_Appendage, Lung, Muscle_Skeletal, Nerve_Tibial, Pituitary, Testis, Thyroid