rs213887 chr5:95647007 T>C
- Sequence
ggcttccgcccaggcacaggagac[T/C]caccgagcttgttcaccttgaaac
- ASB in cell types
- K562 (myelogenous leukemia) GM12878 (female B-cells) HepG2 (hepatoblastoma) liver
- ASB for transcription factors
- NCOR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NCOR1_HUMAN | 1.63 | -0.90 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Breast_Mammary_Tissue, Heart_Atrial_Appendage, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid