rs214101 chr11:17267807 A>G
- Sequence
gaagatgaaaagtcagagctgagg[A/G]atgcagagaggctatgatgatatt
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) coronary artery smooth muscle keratinocytes K562 (myelogenous leukemia)
- ASB for transcription factors
- SNAI2_HUMAN CREB1_HUMAN JUND_HUMAN JUN_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SNAI2_HUMAN | 2.24 | 0.18 | 1.50 | n/a | No Hit | |||
| CREB1_HUMAN | 2.56 | -0.45 | 2.00 | n/a | No Hit | |||
| JUND_HUMAN | 2.00 | -2.26 | 1.33 | n/a | No Hit | |||
| JUN_HUMAN | 2.24 | -1.45 | 1.67 | n/a | No Hit | |||
| FOS_HUMAN | 2.63 | n/a | 2.00 | n/a | n/a |
Items per page:
1 – 5 of 6
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, body mass index (bmi), diastolic blood pressure (dbp), height, serum creatinine, systolic blood pressure (sbp)
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Left_Ventricle, Liver, Lung, Nerve_Tibial, Ovary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Thyroid, Whole_Blood