rs214484 chr21:25881968 C>G
- Sequence
agttacacagatgctgtgctccat[C/G]tagccaccaggtggcggtggaaac
- ASB in cell types
- GM12878 (female B-cells) T47D (invasive ductal carcinoma) HeLa S3 (cervical adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | 0.50 | 0.65 | 1.28 | |||
| T47D (invasive ductal carcinoma) | -0.36 | 1.64 | 2.00 | |||
| HeLa S3 (cervical adenocarcinoma) | -1.21 | 1.62 | 2.00 |
Items per page:
1 – 3 of 3