rs214485 chr21:25882009 C>A
- Sequence
gtggaaaccttgacgcgcttgcaa[C/A]gtgtccagtggttgtttctggttc
- ASB in cell types
- HEK293 (embryonic kidney) HeLa Kyoto (cervical adenocarcinoma) HeLa S3 (cervical adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.48 | 0.87 | 3.30 | |||
| HeLa Kyoto (cervical adenocarcinoma) | 1.03 | -0.43 | 2.00 | |||
| HeLa S3 (cervical adenocarcinoma) | -1.20 | 1.51 | 2.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Lung, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid