rs2145698 chr20:50624748 G>A
- Sequence
ccagacaagcttccagacgggcac[G/A]tgcaacctgccggccccagccctc
- ASB in cell types
- ZR-75-1 (invasive ductal carcinoma) liver
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| ZR-75-1 (invasive ductal carcinoma) | -0.35 | 0.80 | 1.33 | |||
| liver | 1.06 | -1.08 | 1.33 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP comorbid depressive syndrome and alcohol dependence, homa-b, ldl cholesterol, total cholesterol