rs2147539 chr14:61474223 G>T
- Sequence
aggttcttggtgtcaccatcttag[G/T]atctgctcatttttggggttttaa
- ASB in cell types
- monocyte-derived dendritic cells
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| monocyte-derived dendritic cells | 1.71 | -1.56 | 2.00 |
Items per page:
1 – 1 of 1