rs2150696 chr9:12464876 A>G
- Sequence
ctaacacagatattcttaatagtc[A/G]ttcctgcaatattcaatagacgtc
- ASB in cell types
- LNCaP (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LNCaP (prostate carcinoma) | 1.01 | -0.63 | 1.11 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP birth weight, hdl cholesterol, hip bone mineral density (bmd), irritible bowel syndrome, partial epilepsy, severe diabetic retinopathy, systolic blood pressure (sbp), triglycerides change with statins