rs215389 chr12:47370650 G>A
- Sequence
caagaggcagatatgtttgtccac[G/A]agctggttttgccagttgcacttg
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- GRHL2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GRHL2_HUMAN | 0.90 | -0.22 | 1.38 | 0.78 | Weak Discordant |
Items per page:
1 – 1 of 1
Motif analysis
