rs215939 chr6:84756568 A>C
- Sequence
tgcaaatataaacttgattctgca[A/C]agacagtgtacatactaatcaatc
- ASB in cell types
- HEK293 (embryonic kidney) VCaP (prostate carcinoma)
- ASB for transcription factors
- FOXA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXA1_HUMAN | -0.47 | 1.41 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP bipolar disorder in alcoholics, fasting blood glucose, homa-b, intracranial aneurysm, maternal transmission distortion, prop taste detection threshold, refractive error, time to event (myocardial infarction, heart failure, stroke, dementia, hip fracture, cancer or death)