rs216091 chr16:107143 A>G
- Sequence
gcgtaggtcaggaaagaatgctac[A/G]tgctgaacaacagcttaggagcct
- ASB in cell types
- K562 (myelogenous leukemia) MM1.S (plasma cell myeloma) MCF7 (Invasive ductal breast carcinoma) foreskin keratinocyte
- ASB for transcription factors
- CTCF_HUMAN RAD21_HUMAN KDM1A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.71 | 0.71 | 1.45 | n/a | No Hit | |||
| RAD21_HUMAN | 1.08 | -0.14 | 1.67 | n/a | n/a | |||
| KDM1A_HUMAN | -0.83 | 1.76 | 2.00 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP ldl cholesterol change with statins, refractive error, total cholesterol change with statins, triglycerides change with statins, urinary albumin-to-creatinine ratio
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Tibial, Brain_Cerebellar_Hemisphere, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood