rs216175 chr17:2264396 A>C
- Sequence
atgagatgccaaaactacatcttt[A/C]cattggctttgaacaagtccctca
- ASB in cell types
- HEK293 (embryonic kidney) GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.59 | 0.70 | 1.70 | |||
| GM12878 (female B-cells) | 0.72 | 0.25 | 1.30 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP hip bone mineral density (bmd), ldl cholesterol, parkinsons disease, prop taste detection threshold, total cholesterol
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood