rs216334 chr12:6038445 C>T
- Sequence
cccctcacccttgggcaggccggg[C/T]tgggggctcccaggcctcttggtc
- ASB in cell types
- 786-O (renal carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 786-O (renal carcinoma) | -1.84 | 1.85 | 1.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP birth weight, ldl cholesterol, mitral annular calcium, salmonella-induced pyroptosis, venous thrombosis