rs2165635 chr17:75667216 C>A
- Sequence
cgcagtgatgacgtagcgcgagcg[C/A]tggcatgagggcggagccaggcgc
- ASB in cell types
- K562 (myelogenous leukemia) MCF7 (Invasive ductal breast carcinoma) HepG2 (hepatoblastoma) SK-N-SH (neuroblastoma)
- ASB for transcription factors
- CREB1_HUMAN CREM_HUMAN NR2C1_HUMAN EMSY_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CREB1_HUMAN | 2.27 | 0.51 | 1.81 | n/a | No Hit | |||
| CREM_HUMAN | 2.60 | 0.50 | 1.83 | -0.55 | Weak Concordant | |||
| NR2C1_HUMAN | -1.59 | 2.15 | 1.78 | n/a | No Hit | |||
| EMSY_HUMAN | 0.35 | n/a | 2.00 | n/a | n/a | |||
| HIF1A_HUMAN | 2.22 | -1.89 | 2.00 | n/a | No Hit |
Items per page:
1 – 5 of 8
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid, Whole_Blood