rs216730 chr7:28539970 T>G
- Sequence
tgggcataaattgttatggctgtt[T/G]ccaaggatgcatggtacacgtgta
- ASB in cell types
- GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | 0.50 | 0.59 | 1.33 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP comorbid depressive syndrome and alcohol dependence, eye color, hdl cholesterol, hip bone mineral density (bmd), hypertension (early onset hypertension)