rs217259 chr5:138077274 T>C
- Sequence
caacaaaagagcctgttgtactat[T/C]cactgccagcagatggcaggcctt
- ASB in cell types
- K562 (myelogenous leukemia) CD34+ hematopoietic stem cells VCaP (prostate carcinoma) kidney
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.21 | 0.93 | 1.98 | |||
| CD34+ hematopoietic stem cells | 2.36 | -3.32 | 2.00 | |||
| VCaP (prostate carcinoma) | 1.07 | -0.76 | 2.00 | |||
| kidney | n/a | 2.28 | 2.50 | |||
| epidermal keratinocytes | 1.26 | 0.59 | 2.00 |
Items per page:
1 – 5 of 5
Motif analysis
No data available
Genetic associations
GRASP asthma, mitral annular calcium, partial epilepsy, resistance to kuru in aged women despite likely exposure
GTEx eQTL Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Muscle_Skeletal, Ovary, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood