rs217846 chr5:37367180 G>A
- Sequence
caccacagcctcgtgagtagctag[G/A]actacagtgtcatgacaccatgcc
- ASB in cell types
- HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.50 | 0.63 | 2.75 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Coronary, Artery_Tibial, Cells_EBV-transformed_lymphocytes, Lung, Nerve_Tibial, Spleen, Thyroid, Whole_Blood