rs2181779 chr13:27523025 C>T
- Sequence
cccgggaatgaaactcagctgcga[C/T]gcatgcaaggacttcctttatctg
- ASB in cell types
- periferal blood macrophages
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| periferal blood macrophages | -1.45 | 1.40 | 2.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Nucleus_accumbens_basal_ganglia, Breast_Mammary_Tissue, Heart_Left_Ventricle, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid