rs218259 chr4:54539781 A>G
- Sequence
atgctcattgcacagggtcgctgc[A/G]ctgagctcagctgagagattgctt
- ASB in cell types
- adrenal gland Kasumi-1 (acute myeloblastic leukemia)
- ASB for transcription factors
- TFAP4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TFAP4_HUMAN | n/a | 2.31 | 4.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP chronic kidney disease, hematocrit (hct), hemoglobin (hb), mean corpuscular hemoglobin concentration (mchc), mean corpuscular volume (mcv), parkinsons disease, red blood cell count (rbc), systolic blood pressure (sbp)