rs218471 chr20:58652667 C>G
- Sequence
ccgcccgttttcttttaacggccc[C/G]gcagccctctgtgtggccttgttc
- ASB in cell types
- HEK293 (embryonic kidney) GM12878 (female B-cells) CD14+ monocytes
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.87 | -0.18 | 2.01 | |||
| GM12878 (female B-cells) | 0.50 | 0.52 | 1.39 | |||
| CD14+ monocytes | 1.38 | -0.79 | 2.50 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Whole_Blood