rs218634 chr21:36422623 G>A
- Sequence
gagtccgaccatgcctccaggact[G/A]acatgtctgctggttgtcgttgac
- ASB in cell types
- K562 (myelogenous leukemia) SK-N-SH (neuroblastoma) erythroid cells
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.52 | 0.35 | 1.31 | |||
| SK-N-SH (neuroblastoma) | 1.11 | -1.39 | 1.33 | |||
| erythroid cells | 1.55 | n/a | 2.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), diastolic blood pressure (dbp), kidney stones, serum creatinine