rs2195534 chr18:59697596 C>T
- Sequence
ggtacctgcggtgtccggctggcg[C/T]gagggccctgaggttcaagttgtc
- ASB in cell types
- HEK293 (embryonic kidney) foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.87 | -0.18 | 2.37 | |||
| foreskin keratinocyte | 0.44 | n/a | 2.50 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, college completion, height, ldl cholesterol, ldl cholesterol change with statins, mitral annular calcium, obesity with early age of onset (age >2), salmonella-induced pyroptosis, total cholesterol change with statins, triglycerides change with statins
GTEx eQTL Brain_Cortex, Brain_Frontal_Cortex_BA9, Cells_Cultured_fibroblasts, Colon_Sigmoid, Lung, Skin_Sun_Exposed_Lower_leg