rs220149 chr21:42120350 G>T
- Sequence
atcagctctacgactttgtcctaa[G/T]gaatttgatctgtttggaccgtag
- ASB in cell types
- T47D (invasive ductal carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| T47D (invasive ductal carcinoma) | 1.00 | -0.62 | 1.93 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP acute lung injury following major trauma, barnes akathisia rating scale, diastolic blood pressure (dbp), sporadic creutzfeldt-jakob disease, systolic blood pressure (sbp), waist hip ratio
GTEx eQTL Adipose_Visceral_Omentum, Brain_Caudate_basal_ganglia, Brain_Nucleus_accumbens_basal_ganglia, Heart_Left_Ventricle, Pituitary, Stomach, Thyroid, Whole_Blood