rs220314 chr21:42099332 C>T
- Sequence
ttcctccctcccctcccagtcatc[C/T]cactgcctgcccggcattgcaccg
- ASB in cell types
- monocyte-derived macrophages
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| monocyte-derived macrophages | -3.49 | 1.89 | 2.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Adrenal_Gland, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Heart_Left_Ventricle, Lung, Pituitary, Prostate, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Thyroid, Uterus, Whole_Blood