rs2211088 chr10:101142438 A>G
- Sequence
gggcgccctctaggggccgcgcgt[A/G]gcaaggcacttcgagccgaggctc
- ASB in cell types
- A549 (lung carcinoma) foreskin keratinocyte HeLa Kyoto (cervical adenocarcinoma) LoVo (colorectal adenocarcinoma)
- ASB for transcription factors
- SMC3_HUMAN RAD21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SMC3_HUMAN | 0.97 | 0.48 | 2.00 | n/a | n/a | |||
| RAD21_HUMAN | 1.60 | 0.62 | 2.00 | n/a | n/a |
Items per page:
1 – 2 of 2