rs221602 chr17:47174513 G>A
- Sequence
aaaatatgggattagaattataag[G/A]tccataatatattgcataatcatg
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.75 | -0.35 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP college completion, hdl cholesterol change with statins, systolic blood pressure (sbp), total cholesterol change with statins, urinary albumin-to-creatinine ratio, years of education
GTEx eQTL Artery_Aorta, Brain_Amygdala, Brain_Cortex, Heart_Atrial_Appendage, Muscle_Skeletal, Testis, Thyroid, Whole_Blood