rs2228615 chr19:10292692 G>A
- Sequence
gtgacagtaacctgcgcagctggg[G/A]cccaagctctggtcacactggagg
- ASB in cell types
- K562 (myelogenous leukemia) GM12878 (female B-cells)
- ASB for transcription factors
- NRF1_HUMAN NCOR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NRF1_HUMAN | 0.90 | -0.67 | 2.00 | -0.27 | Weak Concordant | |||
| NCOR1_HUMAN | 1.66 | -0.34 | 2.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP abnormal involuntary movement scale, advanced age-related macular degeneration (geographic atrophy), alzheimers disease, college completion, rheumatoid arthritis, soluble intercellular adhesion molecule 1 (icam-1), urinary albumin-to-creatinine ratio
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Heart_Atrial_Appendage, Heart_Left_Ventricle, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Thyroid