rs2230926 chr6:137874929 T>G
- Sequence
acttggtactgaggaaggcgctgt[T/G]cagcacgctcaaggaaacagacac
- ASB in cell types
- CD14+ monocytes
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CD14+ monocytes | 1.63 | n/a | 2.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, hdl cholesterol, rheumatoid arthritis, selective immunoglobulin a deficiency (igad), systemic lupus erythematosus (sle)
PheWAS abnormal chest sounds, abnormal heart sounds, acute osteomyelitis, acute reaction to stress, althetes foot, aneurysm of other specified artery, antisocial/borderline personality disorder, arterial embolism and thrombosis of lower extremity artery, bacterial infection nos, benign neoplasm of brain and other parts of nervous system, bladder cancer, bladder cancer and neoplasms, cancer of kidney and urinary organs, cancer of oropharynx, cancer of other lymphoid, histiocytic tissue, cervical cancer, cervical cancer and dysplasia, cholesteatoma, chronic lymphocytic thyroiditis, cns infection and poliomyelitis, congenital anomalies of lower limb, including pelvic girdle, congenital anomalies of posterior segment of eye, dermatomycoses, disorders of adrenal glands, disorders of the autonomic nervous system, edema, epilepsy, epiphora, fracture of vertebral column without mention of spinal cord injury, hirsutism, hodgkins disease, hypercalcemia, idiopathic fibrosing alveolitis, localized superficial swelling, mass, or lump, lump or mass in breast, mastoiditis, nerve plexus lesions, nerve root and plexus disorders, non-hodgkins lymphoma, other alveolar and parietoalveolar pneumonopathy, other disorders of biliary tract, other disorders of urethra and urinary tract, otorrhea, partial epilepsy, personal history of allergy to medicinal agents, personality disorders, photodermatitis & sunburn, polymyalgia rheumatica, postinflammatory pulmonary fibrosis, posttraumatic stress disorder, premenstrual tension syndromes, prolapse of vaginal walls, psychogenic and somatoform disorders, reticulosarcoma, sexually transmitted infections, somatoform disorder, stiffness of joint, symptoms of the muscles, systemic lupus erythematosus, varicose veins, wheezing