rs2234095 chr14:24195873 C>G
- Sequence
tcgggagaggagtggctgctaggc[C/G]gctcgcttgctcctggaaagattt
- ASB in cell types
- HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.10 | 1.01 | 1.60 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP college completion, fasting insulin, height, homa-b, homa-ir, ldl cholesterol, total cholesterol
GTEx eQTL Adipose_Visceral_Omentum, Artery_Tibial, Brain_Cerebellum, Brain_Frontal_Cortex_BA9, Esophagus_Mucosa, Heart_Left_Ventricle, Lung, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Testis, Thyroid, Whole_Blood