rs2234197 chr20:44960400 G>A
- Sequence
cccgtgtggtgcggcacaccttcc[G/A]ggcgcaagcgccggcggcgaatat
- ASB in cell types
- HepG2 (hepatoblastoma) GM12878 (female B-cells) CD14+ monocytes foreskin keratinocyte
- ASB for transcription factors
- NRF1_HUMAN GABPA_HUMAN STAT1_HUMAN CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NRF1_HUMAN | -0.67 | 1.67 | 1.42 | -2.41 | Discordant | |||
| GABPA_HUMAN | 1.81 | -1.84 | 1.33 | -4.75 | Concordant | |||
| STAT1_HUMAN | 2.11 | -2.82 | 2.50 | n/a | No Hit | |||
| CTCF_HUMAN | 1.12 | -0.20 | 1.64 | n/a | No Hit | |||
| FOXK2_HUMAN | 1.68 | -0.68 | 1.42 | n/a | n/a |
Items per page:
1 – 5 of 5
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Coronary, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Left_Ventricle, Liver, Lung, Minor_Salivary_Gland, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Thyroid, Whole_Blood